Find Single-Cutter Restriction Enzymes in Seqqio Before Planning a Digest
Choose an enzyme shortlist before calculating a digest. A small, executed example shows how cut counts, enzyme-panel scope and circular topology change the decision.
This is the selection step before fragment analysis. If you already know which enzymes you want and need fragment lengths or ends, use the existing Restriction Digest guide. Here the practical question is narrower: which enzymes in my chosen panel deserve a closer look?
Define the sequence and the enzyme panel
Open Restriction Summary, enter the control sequence below, select linear DNA, and choose EcoRI, BamHI and HindIII. This deliberately small panel makes every count easy to inspect. For your own construct, use the complete sequence relevant to the decision, including vector or insert context when those regions matter.
>panel_control
CCGAATTCGGGATCCGGAATTCAA
The panel is part of the result. “No single cutter found” means none among the enzymes actually evaluated; it is not a search of every available restriction enzyme. Preserve the enzyme names and any reported unsupported cases when you export the summary.
Use the counts to make a shortlist
| Enzyme | Predicted cleavage count | Shortlist interpretation |
|---|---|---|
| EcoRI | 2 | Multiple cutter in this sequence |
| BamHI | 1 | Single-cutter candidate |
| HindIII | 0 | Non-cutter in this panel and sequence |
BamHI is the single-cutter candidate in this example. EcoRI may still be useful if a two-site digest answers your question; its exclusion from a single-cutter shortlist does not make it unsuitable for every experiment. HindIII is a useful non-cutter only relative to the exact input sequence and the chosen recognition model.
Review recognition and cleavage information separately when the report distinguishes them. A recognition pattern can occur near the end of a linear molecule while a required cleavage position falls outside that molecule. Such a boundary-excluded case is different from an enzyme with no recognized site. Likewise, an unsupported enzyme rule is not evidence for zero cuts.
Check a site that crosses the circular origin
Topology can change the answer even when the stored sequence letters do not change. Use this second control with EcoRI selected. Read it as linear DNA first, then as circular DNA.
>origin_control
AATTCCCCG
| Topology | Predicted EcoRI cleavages | Reason |
|---|---|---|
| Linear | 0 | The GAATTC recognition sequence is not contiguous within the written string |
| Circular | 1 | The final G joins the initial AATTC across the chosen origin |
The nine-base input is a mathematical boundary test, not a proposed physical plasmid or evidence that such a tiny circle can be prepared. Its purpose is to expose the wrap-around behavior. In a real circular construct, the sequence origin is a coordinate convention; an enzyme site spanning that origin still belongs to the molecule.
New England Biolabs’ NEBcutter documentation also presents cut-count selection and linear/circular topology as useful restriction-analysis controls. Seqqio’s counts in these tables come from its own executed core, not from a claim that the two tools have identical enzyme catalogs or every boundary rule in common.
Move the candidate into a fragment-level check
After shortlisting an enzyme, open Restriction Digest with the same sequence, topology and selected enzyme. Check the predicted fragments and cleavage details against the design. Keep the selected record identity attached to the settings; copying an enzyme name from one batch row into a different sequence does not preserve the original decision.
For a double digest, inspect the combination rather than adding separate enzyme counts and assuming the resulting fragments. Coincident sites, molecule boundaries and the actual order of cuts determine the fragment interpretation. Save both the panel summary used for selection and the specific digest report used for the next decision.
Separate sequence predictions from reaction conditions
The software shortlist does not establish buffer compatibility, methylation sensitivity in your sample, reaction completeness, star activity or experimental fragment recovery. Consult the enzyme supplier’s current documentation and the molecular context before planning the reaction. Sequence ambiguity and incomplete construct records also deserve review before relying on a zero-cut result.
Restriction Summary fits a researcher screening a defined enzyme panel across one or more DNA records before opening detailed digest results. Seqqio keeps this step alongside its other DNA tools in a Windows 64-bit workspace. For a single occasional lookup, an established web calculator may be sufficient; the desktop workflow becomes useful when you want to retain inputs, settings and exports together.
References
- New England Biolabs. NEBcutter V3: Determine the restriction enzymes that cut your DNA NEB official tool documentation Enzyme selection by cut count and the distinction between linear and circular molecules.