Primer Mapping in Seqqio: Locate Exact Binding Sites Across Local DNA Templates
Locate individual primer sites in supplied DNA, interpret strand-aware coordinates, and inspect circular-origin matches. Follow executed synthetic examples and understand what a local exact-match map can establish.
Use primer mapping when your immediate question is “Where does each of these oligos match this local template?” That question is distinct from estimating primer Tm or predicting an amplicon from a primer pair. This tutorial separates those tasks so the map supports a decision you can inspect.
Enter named primers and a local DNA target
Open Primer Map, choose the single-sequence input mode, and select Linear DNA under Target topology. In Primer list, paste one FASTA entry per primer, each written 5′ to 3′:
>alpha
GATTAC
>beta
AAGCCC
Paste or load this DNA as the target and run the map. The target is the supplied DNA record; the primer FASTA belongs in the separate primer-list field.
>template_once
CCGATTACAAA
The executed engine returned one site: alpha on the forward strand, bases 3–8. Its 5′ coordinate is 3 and its 3′ coordinate is 8. Beta has no exact site in this target. Coordinates here are one-based and inclusive: the first base is 1, and both reported ends belong to the match.
Read forward and reverse sites in the same template
Keep the same primer list and replace the target with the 25-base record below. Leave topology set to Linear DNA.
>template_multiple
CCGATTACAAAGTAATCGGAAGCCC
| Primer | Strand | Target span | 5′ coordinate | 3′ coordinate |
|---|---|---|---|---|
| alpha | Forward | 3–8 | 3 | 8 |
| alpha | Reverse | 12–17 | 17 | 12 |
| beta | Forward | 20–25 | 20 | 25 |
At target bases 12–17, the supplied forward DNA string contains GTAATC, the reverse complement of alpha's GATTAC. The reverse primer runs from original coordinate 17 toward 12, which is why its 5′ coordinate is larger than its 3′ coordinate. Keep both primers in their own 5′-to-3′ orientation; do not reverse-complement one just because you expect a reverse-strand site.
The official Biopython sequence API documents DNA reverse-complement behavior. Seqqio's site report preserves the original target coordinates while showing the matched sequence in the primer's orientation. In this run, the summary counted two forward sites, one reverse site, and two primers with at least one match.
Include a site that crosses a circular origin
Replace the target with TACCCGAT. With Linear DNA, our control returned no sites. Switch Target topology to Circular DNA and run again. Alpha now matches across the input boundary: bases 6, 7, 8, 1, 2, and 3 spell GATTAC.
| Target / length | TACCCGAT / 8 bases |
|---|---|
| Strand | Forward |
| Start / end | 6 / 3 |
| 5′ / 3′ coordinates | 6 / 3 |
| Wraps origin | True |
| Matched sequence | GATTAC |
An end coordinate smaller than the start is expected for this wrapped site. It does not describe a negative length or a reversed forward primer. The match contains six bases and crosses the declared origin once. Confirm topology from your own molecule and file provenance; Seqqio does not infer circularity from a sequence string.
Distinguish zero matches from unresolved target bases
With the original alpha and beta primers, the concrete linear target CCCGGGCCCGGG returned zero sites. That is a completed exact search of that record, not a service failure. It does not rule out mismatched binding, matches in other records, or off-targets in an unsearched reference.
Now consider alpha against CCGANTACAAA. The target contains N inside the possible six-base span. Seqqio reports zero known exact sites and records one ambiguous target base. It does not treat N as a wildcard that proves a match; any candidate spanning an unresolved target base remains unassessed. Preserve that uncertainty when interpreting a zero-site result.
Primer ambiguity has a different rule. The degenerate primer GATYAC, where Y allows C or T, matched the concrete target CCGATCACAAA at bases 3–8 in our control. IUPAC choices in a primer can match allowed concrete target bases. They do not resolve an ambiguous target sequence.
Keep strand events distinct from physical loci
The primer ACGT is its own reverse complement. Against TTACGTAA, Seqqio returned a forward and a reverse site at the same target span, 3–6. Those are two strand-specific events at one coordinate interval, not two different physical locations. Read strand and interval together before interpreting the site count.
Primer Map applies full-length exact matching. It has no mismatch allowance, thermodynamic model, or special treatment of a nonmatching 5′ tail. A primer definition containing such a tail is still searched in full. Use the explicitly stated matching rule for your analysis rather than assuming the tool silently trims or tolerates sequence differences.
Map a FASTA batch and retain the evidence
Choose the FASTA batch input mode to apply the primer list independently to supplied target records. Retain meaningful target headers, inspect each original record, and confirm the chosen topology is appropriate for the job. A site never crosses a FASTA-record boundary. Short or highly degenerate primers can generate many sites, so workload and result limits matter; a limit error is separate from a successful zero-site search.
Save Binding sites TSV for the individual hits, Report TSV for per-target summaries, Run metadata JSON for the run settings, and Input FASTA for the analyzed targets. Keep the named primer definitions and method profile Seqqio-PrimerMap-Exact-v1 with those files. This connects a reported coordinate to the actual primer, target, and topology used.
Choose the next analysis from the question
Use the Seqqio PCR Primer Analysis guide to inspect an individual oligo's reported properties and assumptions. Use the PCR Products tutorial when you need exact-match primer-pair orientation and modeled amplicon size. Primer Map lists individual sites; it does not itself convert them into a primer-pair amplification prediction.
For a reference-database specificity question, NCBI Primer-BLAST provides database, organism, and mismatch settings for assessing possible unintended targets. Choose that search scope deliberately. A map of one local construct does not inspect every sequence in a genome, and neither result alone validates an experiment.
Seqqio fits the local inspection step when you already have primer definitions and template files and want explicit coordinates, strands, circular-origin handling, and exportable records. Its practical value is making that bounded step reviewable without writing a mapping script. Use a separate workflow for mismatch-aware off-target assessment or experimental primer selection.
Primer Map is included in Seqqio's 39-application Windows 64-bit toolkit. The current offer is a US$99 one-time purchase with no activation key. Review the platform requirements and final checkout total on the product page.
References
- Biopython contributors. Bio.Seq module Biopython 1.88 API documentation Official DNA reverse-complement context; Seqqio's exact-site and target-ambiguity rules are its own.
- National Center for Biotechnology Information. Primer designing tool: Primer-BLAST NCBI official tool and parameter documentation Database, organism, and mismatch settings for the separate primer-specificity assessment job.