In Silico PCR in Seqqio: Check Primer Orientation, Amplicon Size, and Circular Templates

Test an existing primer pair against one sequence or a FASTA batch, inspect every eligible exact-match amplicon, and separate sequence geometry from PCR specificity.

This distinction makes the tool useful for a focused question: “Given these two primer sequences and this template, what products satisfy the stated geometry?” The scientific method is recorded as Seqqio-PcrProducts-v1, so exported results identify the matching rule used.

Enter the primers in their synthesized orientation

Open PCR Products. Enter Primer A and Primer B as 5-prime-to-3-prime sequences, exactly as synthesized. Choose Single sequence for one template or FASTA batch for independent records. Set the template topology to linear or circular, then choose the minimum and maximum permitted product length.

The built-in example loads a 20-base Primer A (TCGCTTAAACAAACATAGGG), a 20-base Primer B (TTACGGCAGGAGAGGCATGT), and synthetic controls. The records include a complete pair, two target copies, the opposite template orientation, a no-site control, and—when circular topology is selected—an origin-spanning case. Those controls demonstrate software behavior; they are not validated experimental primers.

Settings that change the product list
SettingEffect
Linear topologyProducts must lie within the displayed sequence ends
Circular topologyAn eligible product may cross the coordinate origin
Minimum and maximum lengthFilters primer-pair intervals by primer-inclusive product size
IUPAC symbols in primersAllow a primer symbol to match its represented concrete bases
Repeated binding sitesCan produce multiple coordinate-distinct products

Run the search and inspect orientation

Run the analysis and open each successful record. A product includes both primer regions and the sequence between them. Check the product length, the primer assignment, orientation, one-based inclusive coordinates, and the wraps origin indicator for circular templates. Distinct products are retained even if they have identical sequence but arise at different coordinates.

A zero-product result is a completed analysis, not a software error. It means no interval met all current rules. Work through the settings in order: confirm the 5-prime-to-3-prime primer text, topology, size range, and template record. Under Seqqio's model, template ambiguity cannot establish an annealing site, although ambiguous symbols inside the intervening product are retained.

How to interpret common outcomes
OutcomeSupported conclusionNext check
One exact productOne interval satisfies the Seqqio sequence and size rulesAssess thermodynamics and specificity separately
Several productsRepeated or alternative exact sites support several intervalsInspect coordinates and template identity
Origin-spanning productThe primer geometry is possible on the selected circular sequenceConfirm that circular topology is biologically appropriate
No productsNo interval satisfies every current ruleReview primer text, topology, and size limits

Separate exact matching from primer specificity

Seqqio does not allow primer mismatches in this tool, score 3-prime mismatch risk, interpret non-annealing 5-prime tails, calculate melting temperature, model salt or secondary structure, estimate product yield, or search a reference database for unintended targets. A returned product therefore shows exact sequence compatibility with the supplied record; it does not prove experimental specificity or amplification.

For broader specificity assessment, use NCBI Primer-BLAST against the appropriate database. Primer-BLAST evaluates whether primer pairs can generate products on unintended sequences and includes thermodynamic design controls. Its original methods paper explains how primer design and BLAST-based specificity checking are combined.

Export a reviewable product set

Save the FASTA and TSV outputs together with the run metadata. The product FASTA supports downstream sequence work; the tabular report preserves template identity, coordinates, orientation, product length, and status. In a batch, each record remains independent and a failed item does not erase valid sibling results.

When Seqqio PCR Products is a good fit

Use this workflow to check known primer pairs against local templates, teach primer orientation, inspect repeated exact sites, or trace origin-spanning products on circular constructs. Choose a primer-design and database-search service when the main question is which primers to order or whether they are specific across a genome.

PCR Products belongs to the 39-application Seqqio desktop workspace for Windows 64-bit. See the Seqqio application overview for its shared batch, history, and export workflow. The toolkit is available as a US$99 one-time purchase with no activation key.

References

  1. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction BMC Bioinformatics (2012) DOI: 10.1186/1471-2105-13-134 Primary methods source for primer design and database-based specificity checking.
  2. National Center for Biotechnology Information. Primer-BLAST NCBI web application Current official interface and documentation for primer design, product-size controls, and specificity searches.