Introduce a Restriction Site with a Synonymous Mutation in Seqqio
Declare a complete CDS and permitted interval, search for restriction sites that can be introduced without changing its translation, and inspect every exact edit.
The method is Seqqio-MutateForDigest-Synonymous-v1. It is designed for a bounded engineering question: can one explicitly declared, contiguous CDS be recoded within an allowed interval to create a modeled restriction site? Seqqio does not infer the CDS, select the genetic code for you, design primers, remove existing sites, or optimize expression.
Declare the complete CDS and allowed interval
Open Mutate for Digest and enter concrete linear DNA. Choose the coding strand and biologically appropriate NCBI code. Declare either that the whole input is a complete CDS or enter one-based inclusive CDS coordinates. The declaration must include a recognized start, a terminal stop, a length divisible by three, and no internal stop under the selected code.
Next choose whether substitutions may occur anywhere in the CDS or only inside a smaller interval, set a maximum of one to six nucleotide substitutions, and select between one and 32 enzyme definitions. Context-dependent stop tables 27, 28, and 31 are excluded from this design profile. Coordinates are validated independently for every FASTA record.
| Check | Guarantee inside the method |
|---|---|
| Translation | The complete declared CDS translates to the same protein before and after the edits |
| Target recognition | Exactly one new complete target-enzyme recognition is introduced |
| Whole molecule | Every selected enzyme is rescanned across the full linear DNA |
| Edits | Positions, original bases, replacement bases, and changed codons are reported |
| Search scope | Enumeration is exhaustive within the local codons that can overlap the proposed motif and the stated edit limit |
Reproduce a verified EcoRI candidate
Use the synthetic DNA CCAAATGGAGTTTTAATTGG. Declare bases 5-16 as the forward CDS and as the permitted interval, select NCBI Code 1, allow two substitutions, and include EcoRI with the recognition sequence GAATTC. The original CDS translates to MEF.
The executed Seqqio search returned one candidate. It changes base 10 from G to A and base 13 from T to C, producing CCAAATGGAATTCTAATTGG. The new EcoRI recognition spans bases 8-13. Two codons change, one complete site is added, no selected site is lost, and retranslation still produces MEF.
| Original DNA | CCAAATGGAGTTTTAATTGG |
|---|---|
| CDS / allowed interval | 5-16 / 5-16 |
| Exact edits | 10 G to A; 13 T to C |
| Candidate DNA | CCAAATGGAATTCTAATTGG |
| New recognition | EcoRI, bases 8-13 |
| Protein before / after | MEF / MEF |
Inspect the candidate before using it
Select the candidate number in Seqqio to compare original and edited sequence context, exact substitutions, recognition and cleavage counts for every selected enzyme, and all added or lost sites. The ordering favors fewer substitutions and changed codons before stable coordinate criteria; it is a deterministic convenience order, not a prediction of experimental quality.
Use the Restriction Digest tutorial to inspect the complete candidate digest and the Translation tutorial for a separate sequence-level check. Handoff buttons preserve the candidate and settings, but a destination workspace does not silently run another analysis.
Synonymous does not mean biologically neutral
Seqqio proves unchanged amino-acid output under the selected code. It does not model expression, codon bias, RNA structure, splicing, methylation, overlapping genes, regulatory motifs, protein folding, reaction buffer, or cleavage efficiency. Research on synonymous variants and messenger-RNA structure shows why a protein-preserving edit can still affect biology.
The NCBI genetic-code reference supports the code choice, and the Biopython translation API provides an independent translation reference. Seqqio's validation compared complete-CDS translation and whole-site rescans with independent Biopython results, but a proposed construct still needs domain review and laboratory confirmation.
When this design workflow is a good fit
Use Mutate for Digest when you already know the exact complete CDS, enzyme set, and editable interval and want an auditable shortlist of protein-preserving designs. Choose a broader construct-design platform when introns, overlapping features, host-specific expression, primer construction, assembly strategy, or several linked sequence constraints must be optimized together.
Mutate for Digest belongs to the 39-application Seqqio workspace for Windows 64-bit. The Seqqio overview explains the local record, history, and export model. The toolkit is available as a US$99 one-time purchase with no activation key.
References
- Shen X et al.. Synonymous variants that disrupt messenger RNA structure are significantly constrained in the human population Genome Research (2021) DOI: 10.1101/gr.269233.120 Primary evidence that protein-preserving variants can affect messenger-RNA structure and regulation.
- National Center for Biotechnology Information. The Genetic Codes NCBI Taxonomy genetic-code reference Authoritative start, stop, and codon assignments used to interpret a complete CDS.
- Biopython contributors. Bio.Seq module Official Biopython API documentation Independent sequence-translation reference used in scientific validation.